What is a good A260/280 ratio for DNA?

A pure DNA sample should have an A260/A280 ratio of approximately 1.8. Ratios between 1.7 and 2.0 are generally considered acceptable for DNA. A ratio significantly below 1.8 (e.g., below 1.5) indicates protein or phenol contamination. A ratio above 2.0 may indicate RNA contamination. For pure RNA, the target A260/A280 ratio is approximately 2.0.

Shahid Ali

Lead Developer · CECOS University of IT and Emerging Sciences · ORCID: 0009-0008-5995-4438

Fact-Checked DOI Archived Last verified: August 2026

Molecular Biology Tool

DNA Molecular Weight Calculator

Calculate DNA molecular weight from sequence or length, convert between ng/µL, nM, and pmol, and determine DNA concentration and purity from A260/A280 spectrophotometer readings — the complete DNA calculator for molecular biology labs.

650 g/mol per dsDNA bp

1.8 A260/A280 target (DNA)

50 µg/mL per A260 unit (dsDNA)

330 g/mol per ssDNA nt

DNA Calculator — MW, Concentration, Purity & Base Count

How to Use This Calculator

Choose Mode A (paste your sequence) for a precise, base-composition-based MW, or Mode B (enter length only) for a quick approximation.

Select your strand type: dsDNA (double-stranded, e.g. PCR products, plasmids), ssDNA (oligos, primers), or RNA.

Click Calculate. The result shows MW in g/mol, Da, and kDa, plus a full breakdown of the residue-weight calculation.

Use the "Use this MW" button that appears in the result to send the MW directly to the Concentration Converter tab.

Paste DNA/RNA sequence (FASTA headers stripped automatically):

Strand type:

ATGCGTACGGCTAACGTTAGC (ssDNA)

1,000 bp dsDNA

20 bp dsDNA oligo

ATGCGT (dsDNA)

Error

Molecular Weight (DNA Molecular Weight)

—

Calculation Breakdown

How to Use This Calculator

Select the conversion mode: ng/µL→nM, nM→ng/µL, ng/µL→pmol/µL, or pmol→ng.

Enter your concentration value and MW in g/mol. Tip: use the "Use this MW" button from Tool 1 to auto-fill MW from your sequence.

Or enter sequence length + strand type for an instant approximate MW (650 g/mol/bp for dsDNA, 330 g/mol/nt for ssDNA).

Click Convert to see results plus a full unit conversion grid (ng/µL, µg/mL, nM, µM, pmol/µL).

Conversion mode:

Concentration (ng/µL):

MW (g/mol):

— OR — Estimate MW from sequence length:

Length (bp or nt):

Strand type (for estimate):

50 ng/µL, 20bp dsDNA

500 ng plasmid → pmol

100 ng/µL, 20-mer ssDNA

3846 nM → ng/µL

Error

DNA Concentration — Converted Result

—

Calculation Steps

Full Unit Conversion Grid:

How to Use This Calculator

Enter your A260 and A280 absorbance readings from your Nanodrop or spectrophotometer. These are typically in the range 0.1–2.0 for well-diluted samples.

Enter the dilution factor (enter 1 if measuring undiluted, 10 if you diluted 1:10, etc.).

Select sample type (dsDNA, ssDNA, or RNA) to apply the correct extinction coefficient (50, 33, or 40 µg/mL per A260 unit).

Click Calculate to see DNA concentration in ng/µL, the A260/A280 ratio, and a color-coded purity verdict explaining what your ratio means.

A260 reading:

A280 reading:

Dilution factor:

Sample type:

Nanodrop users: The Nanodrop uses a 0.1 mm path length but automatically normalizes readings to 1 cm equivalent. Enter the A260/A280 values directly from your Nanodrop readout — no path-length correction needed.

A260=0.85, A280=0.47, ×10 dsDNA (good)

A260=0.60, A280=0.45, ×1 (contaminated)

RNA sample A260=0.40

ssDNA A260=1.2, ×5

Error

A260/A280 Purity Ratio

—

DNA Concentration Calculation

How to Use This Calculator

Paste any DNA or RNA sequence (FASTA headers are stripped automatically). Whitespace and numbers are ignored.

Click Count Bases to instantly see sequence length, GC%, AT%, and a full base composition table.

For full molecular weight calculation from this sequence, click "Use in MW Calculator" to send it to Tool 1.

Paste sequence:

ATGCGTACGGCTAACGTTAGC

GAATTCGGATCCCTCGAG

ATGNRYATGC

Error

Base Composition

Base	Count	Percentage	Residue Weight (g/mol)

Quick Reference — DNA Quantification Formulas

1MW from Sequence (Residue Weight Method)

ssDNA: MW = (nA × 313.21) + (nT × 304.2) + (nG × 329.21) + (nC × 289.18) + 79.0

dsDNA: MW = ssDNA MW × 2 (complementary strand adds approximately equal mass)

RNA: MW = (nA × 329.2) + (nU × 306.2) + (nG × 345.2) + (nC × 305.2) + 159.0

The +79.0 terminal correction accounts for the 5'-phosphate group. These residue weights are for the phosphodiester chain form (residue = nucleotide monophosphate minus water, connected in chain).

2MW from Length (Approximation)

dsDNA: MW ≈ length (bp) × 650 g/mol/bp — includes both strands, accurate to ~2% for typical GC content

ssDNA: MW ≈ length (nt) × 330 g/mol/nt — single strand approximation

RNA: MW ≈ length (nt) × 340 g/mol/nt — ribonucleotide average (slightly heavier than deoxyribonucleotide)

3Concentration Conversions

nM = (ng/µL × 10⁶) / MW(g/mol)

ng/µL = (nM × MW) / 10⁶

pmol/µL = (ng/µL × 1000) / MW

ng = (pmol × MW) / 1000

Note: ng/µL = µg/mL numerically (same concentration, different notation).

4A260 Concentration Formula

Concentration (µg/mL) = A260 × dilution factor × extinction coefficient

Standard extinction coefficients (µg/mL per A260 unit, 1 cm path length):

dsDNA = 50 | ssDNA = 33 | RNA = 40 | Oligonucleotides ≈ 20–33 (sequence-dependent)

A260/A280 ratio = A260 / A280 — target: ~1.8 for pure DNA, ~2.0 for pure RNA.

How to Calculate DNA Molecular Weight — Formula and Method

The molecular weight of DNA depends on its base composition, length, and whether it is double-stranded or single-stranded. This DNA molecular weight calculator supports two methods: the precise residue-weight method (using the actual sequence) and the standard laboratory approximation (using only the length).

The Quick Approximation (Most Labs Use This)

For routine work, the accepted laboratory approximations are: dsDNA: 650 g/mol per base pair, ssDNA: 330 g/mol per nucleotide, RNA: 340 g/mol per nucleotide. These are accurate enough for virtually all standard calculations.

dsDNA: MW ≈ length (bp) × 650 g/mol ssDNA: MW ≈ length (nt) × 330 g/mol | RNA: MW ≈ length (nt) × 340 g/mol

The Precise Residue-Weight Method

For exact calculations, use individual base residue weights. Each nucleotide residue in the phosphodiester chain has a specific mass: dAMP = 313.21 g/mol, dTMP = 304.2 g/mol, dGMP = 329.21 g/mol, dCMP = 289.18 g/mol. Add 79.0 g/mol once for the 5'-terminal phosphate correction. GC-rich sequences are slightly heavier than AT-rich sequences — but the 650/330 g/mol approximation is typically within 2–3% of the precise value.

Worked Example 1: ssDNA Oligo ATGCGTACGGCTAACGTTAGC (21 nt)

Count bases: A=6, T=6, G=5, C=4
Apply residue weights: (6×313.21) + (6×304.2) + (5×329.21) + (4×289.18) + 79.0
= 1,879.26 + 1,825.20 + 1,646.05 + 1,156.72 + 79.0
MW = 6,586.23 g/mol ≈ 6.59 kDa
Approximation check: 21 × 330 = 6,930 g/mol (within ~5%)

Worked Example 2: dsDNA Plasmid, 4,700 bp

Use the 650 g/mol/bp approximation: 4,700 × 650 = 3,055,000 g/mol
MW ≈ 3,055,000 g/mol = 3,055 kDa ≈ 3.06 MDa
Note: The 650 g/mol per bp figure already includes both strands of the dsDNA duplex.

Converting DNA Concentration — ng/µL to nM and pmol

Spectrophotometers measure mass concentration (ng/µL or µg/mL). But many molecular biology protocols — PCR, ligation, Gibson assembly — require molar concentrations (nM, µM, or pmol amounts) because reactions need equimolar ratios, not equal masses. A short 20-mer oligo and a long 3 kb plasmid at the same ng/µL have very different molar concentrations.

nM = (ng/µL × 10⁶) / MW (g/mol) The 10⁶ factor converts ng→g (×10⁻⁹) and µL→L (×10⁻⁶) and mol→nmol (×10⁹) simultaneously

Example 1: ng/µL → nM (oligo at 50 ng/µL)

20 bp dsDNA oligo: MW = 20 × 650 = 13,000 g/mol
nM = (50 × 10⁶) / 13,000 = 3,846 nM ≈ 3.85 µM

Example 2: pmol → ng (total amount in a tube)

500 ng of a plasmid with MW = 3,000,000 g/mol
pmol = (500 × 1,000) / 3,000,000 = 0.167 pmol
0.167 pmol of plasmid in that 500 ng sample

Example 3: nM → ng/µL (making up a working stock)

You want 100 nM of a ssDNA primer (30-mer, MW ≈ 30 × 330 = 9,900 g/mol)
ng/µL = (100 × 9,900) / 10⁶ = 0.99 ng/µL
100 nM primer = 0.99 ng/µL

A260/A280 Ratio — What It Means for DNA Purity

The A260/A280 ratio is the most widely used metric for assessing DNA purity in a molecular biology lab. Every Nanodrop reading automatically calculates it. Understanding what the ratio means — and why deviations in each direction indicate different contaminants — is essential for interpreting DNA quantification data.

The Beer-Lambert Law Foundation

DNA absorbs UV light maximally at 260 nm because of the stacked aromatic rings of the nucleobases. Proteins absorb maximally at 280 nm due to aromatic amino acid residues (phenylalanine, tyrosine, tryptophan). By measuring at both wavelengths, you can estimate the relative amounts of nucleic acid and protein in your sample.

A260/A280 ratio targets: ~1.8 for pure DNA, ~2.0 for pure RNA. These are not thresholds — they are empirically determined values for highly purified samples. Values of 1.7–2.0 for DNA are generally acceptable for downstream applications.

A260/A280 Ratio	Interpretation	Likely Cause	Action
~1.8	✓ Pure DNA	No significant contamination	Proceed with experiments
~2.0	✓ Pure RNA	Target for RNA samples	Proceed with experiments
1.7–2.0	✓ Acceptable DNA	Trace contamination	Acceptable for most applications
<1.7	⚠ Borderline	Protein, phenol, or salt	Consider re-purification
<1.5	✗ Poor — protein contamination	Incomplete protein removal; phenol carryover from phenol-chloroform extraction	Re-purify: column cleanup, phenol-chloroform, or ethanol precipitation
>2.0 (DNA sample)	⚠ Possible RNA contamination	RNA co-purified with DNA; or A280 near noise floor	Treat with RNase A; re-measure
>2.2	✗ Poor — significant RNA or artefact	Heavy RNA contamination; or A280 = near zero (noisy low reading)	RNase treatment; re-purify; verify sample is not too dilute

Why Low Ratio = Protein (Not RNA)

When A260/A280 < 1.8 for a DNA sample, protein contamination is the first suspect. Protein absorbs strongly at 280 nm, raising A280 relative to A260 and dragging the ratio down. Phenol (from phenol-chloroform extractions) also absorbs at 270–280 nm and will produce a low ratio even with minimal protein. SDS and other detergents can similarly lower the ratio.

Why High Ratio = RNA (Not "Extra Pure")

A common misconception is that a higher A260/A280 ratio means "extra pure" DNA. This is wrong. Pure dsDNA targets 1.8 — not 2.0, not 2.5. An elevated ratio for a DNA sample almost always indicates RNA contamination. RNA has a naturally higher intrinsic A260/A280 ratio (~2.0), so RNA carryover pushes a DNA sample's ratio above 1.8. Treat with RNase A and re-quantify.

Extinction Coefficients for Nucleic Acid Quantification

The extinction coefficient (also called the Beer-Lambert extinction factor) determines how much UV light a given concentration of nucleic acid absorbs at 260 nm. These are the standard values used in every molecular biology lab:

Sample Type	Extinction Coeff.	Meaning	Source
dsDNA	50 µg/mL per A260	An A260 reading of 1.0 corresponds to 50 µg/mL dsDNA concentration	Sambrook & Russell (Molecular Cloning)
ssDNA	33 µg/mL per A260	An A260 of 1.0 = 33 µg/mL ssDNA (lower because ssDNA absorbs more per µg due to unstacked bases)	Standard laboratory convention
RNA	40 µg/mL per A260	An A260 of 1.0 = 40 µg/mL RNA	Standard laboratory convention
Oligonucleotides	20–33 µg/mL per A260	Varies by sequence; use nearest-neighbor method for short oligos for precision	IDT OligoAnalyzer (nearest-neighbor)

For short synthetic oligonucleotides, the flat 33 µg/mL approximation introduces significant error because individual bases have very different molar extinction coefficients (A absorbs much more strongly than C at 260 nm). For precise oligo quantification, use the nearest-neighbor method — IDT's OligoAnalyzer tool calculates sequence-specific extinction coefficients for custom oligos. For standard genomic DNA, PCR products, and plasmids, the values in the table above are entirely sufficient.

Common Mistakes in DNA Quantification

Mistake 1 — Using the Wrong Extinction Coefficient

❌ Using 50 µg/mL for a ssDNA sample (oligo, primer, or PCR product that was denatured)
✅ Use 50 for dsDNA, 33 for ssDNA, 40 for RNA — always match the coefficient to your actual sample type
Error magnitude: using 50 instead of 33 for ssDNA overestimates DNA concentration by ~50%

Mistake 2 — Forgetting the Dilution Factor

❌ Reading A260 from a 1:10 diluted sample and not multiplying by 10
✅ Concentration = A260 × dilution factor × extinction coefficient — the dilution factor is critical
Error magnitude: a forgotten ×10 dilution factor gives a 10× underestimate of DNA concentration

Mistake 3 — Confusing ng/µL with ng/mL

❌ Reporting 50 µg/mL (from the Beer-Lambert formula) as 50 ng/µL → then converting as if this is 50 ng/µL when actually it should equal 50 ng/µL already
✅ Numerically, µg/mL = ng/µL (both = 1 µg/1000 µL = 1000 ng/1000 µL = 1 ng/µL — wait, 1 µg/mL = 1 ng/µL? Yes: 1 µg = 1000 ng, 1 mL = 1000 µL, so 1 µg/mL = 1000 ng / 1000 µL = 1 ng/µL ✓)
The trap: ng/mL ≠ ng/µL. 1 ng/mL = 0.001 ng/µL. Confusing mL and µL gives a 1000× error.

Mistake 4 — Using 650 g/mol/bp for Very Short Oligos

❌ A 10-mer dsDNA oligo calculated at 10 × 650 = 6,500 g/mol — end effects matter for short oligos
✅ For oligos shorter than ~20 bp, use the precise residue-weight method (Tool 1 Mode A) or the ssDNA approximation × 2. The 650/bp figure assumes average base composition and fully accounts for internal phosphodiester bonds; end effects make short oligos slightly lighter than the approximation predicts.

Mistake 5 — Misinterpreting High A260/A280 Ratio as "Very Pure"

❌ A260/A280 = 2.3 for a DNA sample → "Great, super pure DNA!"
✅ For DNA, the target A260/A280 ratio is ~1.8, not 2.0 or higher. A ratio of 2.3 indicates RNA contamination — RNA has an intrinsically higher ratio (~2.0) and its presence raises your DNA sample's ratio above 1.8. Treat with RNase A and re-measure.

Worked Examples

Problem	Formula Used	Result
MW of ssDNA oligo ATGCGTACGGCTAACGTTAGC	Residue weights + 79.0	6,586 g/mol ≈ 6.59 kDa
MW of 1,000 bp dsDNA (approx.)	1,000 × 650	650,000 g/mol = 650 kDa
50 ng/µL of 20-mer dsDNA → nM	(50 × 10⁶) / 13,000	3,846 nM = 3.85 µM
3,846 nM → ng/µL (verify above)	(3846 × 13,000) / 10⁶	50 ng/µL ✓
500 ng plasmid (3 Mb) → pmol	(500 × 1000) / 3,000,000	0.167 pmol
A260=0.85, ×10 dsDNA → concentration	0.85 × 10 × 50	425 µg/mL = 425 ng/µL
A260=0.60, A280=0.45 → purity ratio	0.60 / 0.45	1.33 → ✗ Poor (protein contamination)
MW of 500 nt RNA (approx.)	500 × 340	170,000 g/mol = 170 kDa

Frequently Asked Questions

What is a good A260/A280 ratio for DNA?

A pure DNA sample should show an A260/A280 ratio of approximately 1.8. Values between 1.7 and 2.0 are generally acceptable for most downstream applications including PCR, sequencing, and restriction digestion. A ratio significantly below 1.8 indicates protein or phenol contamination (these absorb strongly at 280 nm). A ratio above 2.0 for a DNA sample suggests RNA contamination. For RNA, the target A260/A280 ratio is approximately 2.0.

How do you calculate DNA concentration from absorbance?

Use the Beer-Lambert Law: Concentration (µg/mL) = A260 × dilution factor × extinction coefficient. Standard extinction coefficients are dsDNA = 50 µg/mL per A260 unit, ssDNA = 33 µg/mL per A260 unit, RNA = 40 µg/mL per A260 unit. For example: A260 = 0.85, dilution = ×10, dsDNA → concentration = 0.85 × 10 × 50 = 425 µg/mL = 425 ng/µL. Use Tool 3 (A260/A280 Purity) above to automate this calculation.

How do you convert ng/µL to nM for DNA?

Use: nM = (ng/µL × 10⁶) / MW (g/mol). The 10⁶ factor handles the unit conversions (ng to g, µL to L, mol to nmol) simultaneously. Example: 50 ng/µL of a 20 bp dsDNA oligo (MW = 13,000 g/mol) → nM = (50 × 1,000,000) / 13,000 = 3,846 nM ≈ 3.85 µM. For the reverse (nM → ng/µL): ng/µL = (nM × MW) / 10⁶.

What is the molecular weight of a typical dsDNA base pair?

The average molecular weight of a double-stranded DNA (dsDNA) base pair is approximately 650 g/mol (Daltons). This is the standard 650 g/mol approximation used in molecular biology labs worldwide. For ssDNA, the approximation is 330 g/mol per nucleotide. These figures already account for the phosphate backbone and sugar. For more precise work, use the residue-weight method in Tool 1 Mode A with the actual sequence — but the 650 g/mol/bp figure is accurate to within ~2–3% for typical GC content sequences.

Why is the dsDNA extinction coefficient different from ssDNA?

The extinction coefficient reflects UV absorbance at 260 nm per unit mass. dsDNA uses 50 µg/mL per A260 unit; ssDNA uses 33 µg/mL per A260 unit. The difference arises from hypochromicity — base stacking in the dsDNA helix reduces UV absorbance compared to unstacked single-stranded bases. ssDNA bases are exposed and absorb more strongly per microgram. Therefore, a given A260 reading corresponds to less mass for ssDNA (lower µg/mL per A260 unit = more concentrated solution needed to reach the same A260).

What does it mean if A260/A280 is above 2.0 for DNA?

For a DNA sample, A260/A280 above 2.0 most commonly indicates RNA contamination. RNA has an intrinsically higher ratio (~2.0 for pure RNA), so any RNA carry-over raises your DNA sample's ratio above the 1.8 target. It can also occur when the A280 reading is very close to the instrument noise floor — measurement error at very low A280 values inflates the ratio artificially. If your DNA sample has a ratio significantly above 2.0, treat with RNase A (37°C, 30 min) and re-purify if necessary before re-measuring.

Related Calculators

Quick Reference

dsDNA: bp × 650 g/mol Standard approximation (both strands)

ssDNA: nt × 330 g/mol Single strand approximation

RNA: nt × 340 g/mol Ribonucleotide average

nM = (ng/µL × 10⁶) / MW Mass → molar concentration

ng/µL = (nM × MW) / 10⁶ Molar → mass concentration

pmol/µL = (ng/µL × 1000) / MW Concentration → pmol

Conc. = A260 × DF × Coeff. Beer-Lambert Law (µg/mL)

Purity = A260 / A280 Target: ~1.8 (DNA), ~2.0 (RNA)

Extinction Coefficients

Type	µg/mL per A260
dsDNA	50
ssDNA	33
RNA	40
Oligonucleotide	20–33

Residue Weights (g/mol)

Base	DNA	RNA
A	313.21	329.2
T/U	304.2 (T)	306.2 (U)
G	329.21	345.2
C	289.18	305.2
+Terminal	+79.0 (5' phosphate)

Related Tools

Data Sources & References

DNA molecular weight calculation methodology: Sambrook, J. & Russell, D.W. (2001). Molecular Cloning: A Laboratory Manual, 3rd ed. Cold Spring Harbor Laboratory Press. Appendix 8 — Nucleic Acid Conversions.
Nucleotide residue molecular weights (dAMP 313.21, dTMP 304.19, dGMP 329.21, dCMP 289.18 g/mol): Thermo Fisher Scientific Technical Reference — DNA and RNA Molecular Weight and Conversions. thermofisher.com
Extinction coefficients at 260nm (dA: 15400, dT: 8700, dG: 11700, dC: 7300 L/mol/cm): Cantor, C.R., Warshaw, M.M. & Shapiro, H. (1970). "Oligonucleotide interactions III." Biopolymers 9(9): 1059–1077. DOI 10.1002/bip.1970.360090909
Average dsDNA molecular weight (650 g/mol per bp): Sambrook, J. & Russell, D.W. (2001). Molecular Cloning, 3rd ed. Cold Spring Harbor Laboratory Press. Table A8.1.
Avogadro constant (6.02214076×10²³ mol⁻¹): CODATA 2018, NIST SP 961. physics.nist.gov

Shahid Ali — Lead Developer, CECOS University Academically Verified

🆔 ORCID: 0009-0008-5995-4438 · 🔭 DOI: 10.5281/zenodo.21796048 · 📊 Figshare Dataset · 📋 Editorial Standards

Calculator methods archived with DOI · Last verified: August 2026

DNA Molecular Weight Calculator – MW, Concentration, A260/280 Purity

DNA Molecular Weight Calculator

How to Calculate DNA Molecular Weight — Formula and Method

The Quick Approximation (Most Labs Use This)

The Precise Residue-Weight Method

Worked Example 1: ssDNA Oligo ATGCGTACGGCTAACGTTAGC (21 nt)

Worked Example 2: dsDNA Plasmid, 4,700 bp

Converting DNA Concentration — ng/µL to nM and pmol

Example 1: ng/µL → nM (oligo at 50 ng/µL)

Example 2: pmol → ng (total amount in a tube)

Example 3: nM → ng/µL (making up a working stock)

A260/A280 Ratio — What It Means for DNA Purity

The Beer-Lambert Law Foundation

Why Low Ratio = Protein (Not RNA)

Why High Ratio = RNA (Not "Extra Pure")

Extinction Coefficients for Nucleic Acid Quantification

Common Mistakes in DNA Quantification

Mistake 1 — Using the Wrong Extinction Coefficient

Mistake 2 — Forgetting the Dilution Factor

Mistake 3 — Confusing ng/µL with ng/mL

Mistake 4 — Using 650 g/mol/bp for Very Short Oligos

Mistake 5 — Misinterpreting High A260/A280 Ratio as "Very Pure"

Worked Examples

Frequently Asked Questions

Related Calculators

Data Sources & References

Pages

DNA Molecular Weight Calculator – MW, Concentration, A260/280 Purity

DNA Molecular Weight Calculator

How to Calculate DNA Molecular Weight — Formula and Method

The Quick Approximation (Most Labs Use This)

The Precise Residue-Weight Method

Worked Example 1: ssDNA Oligo ATGCGTACGGCTAACGTTAGC (21 nt)

Worked Example 2: dsDNA Plasmid, 4,700 bp

Converting DNA Concentration — ng/µL to nM and pmol

Example 1: ng/µL → nM (oligo at 50 ng/µL)

Example 2: pmol → ng (total amount in a tube)

Example 3: nM → ng/µL (making up a working stock)

A260/A280 Ratio — What It Means for DNA Purity

The Beer-Lambert Law Foundation

Why Low Ratio = Protein (Not RNA)

Why High Ratio = RNA (Not "Extra Pure")

Extinction Coefficients for Nucleic Acid Quantification

Common Mistakes in DNA Quantification

Mistake 1 — Using the Wrong Extinction Coefficient

Mistake 2 — Forgetting the Dilution Factor

Mistake 3 — Confusing ng/µL with ng/mL

Mistake 4 — Using 650 g/mol/bp for Very Short Oligos

Mistake 5 — Misinterpreting High A260/A280 Ratio as "Very Pure"

Worked Examples

Frequently Asked Questions

Related Calculators

Share This Tool

Data Sources & References

Pages