/

Reverse Complement Calculator – DNA & RNA Sequence Tool

SA
Shahid Ali
Lead Developer · CECOS University of IT and Emerging Sciences · ORCID: 0009-0008-5995-4438
Fact-Checked DOI Archived Last verified: August 2026
Molecular Biology Tool

Reverse Complement Calculator

Find the reverse complement, complement, and reverse of any DNA or RNA sequence instantly. Supports IUPAC ambiguity codes, FASTA input, GC content analysis, palindrome detection, and DNA-to-mRNA transcription. The most complete complementary sequence tool available.

Original 5'→3': 5'-A T G C G T A C-3'
| | | | | | | |
Complement 3'→5':3'-T A C G C A T G-5'
↕ flip strand ↕
Rev.Comp. 5'→3': 5'-G T A C G C A T-3'
Reverse Complement, Complement & Reverse — All in One Tool
FASTA header detected and excluded from calculation. Processing sequence only.
Large sequence — calculation may take a moment.
Sequence contains both T and U — please verify your sequence type selection.
Sequence Type
ATGCGTACGGCTAACGTTAGC
ATGNRYATGC (ambiguity)
GAATTC (EcoRI palindrome)
GGATCC (BamHI palindrome)
AATTCGGGCCC
ATGC (simple)
Error
✓ This sequence is palindromic (reads the same on both strands) — common in restriction enzyme recognition sites.
Double-Helix Relationship — Visual

⬆ The complement strand (bottom) reads 3'→5' in the same left-to-right order. Flipping it gives the reverse complement reading 5'→3' — the biologically standard orientation of the antiparallel strand.

🔄 Reverse Complement (5'→3') — Antiparallel Strand
Original (5'→3')
Complement (3'→5', same order)
Reverse (order flipped, no base pairing)
Sequence Statistics
BaseCountPercentage

→ For molecular weight, see our 🧬 DNA Molecular Weight Calculator

Complement Only — replaces each base with its Watson-Crick partner, keeping the same left-to-right sequence order. For DNA: A pairs with T, T pairs with A, G pairs with C, C pairs with G. For RNA: A pairs with U, U pairs with A, G pairs with C, C pairs with G.

ATGCGT
GGATCC
ATGNRY
Error
Complement (3'→5', same order)

⚠️ Direction note: This shows the complementary bases in the same left-to-right order as your input. Biologically, this represents the antiparallel strand — but written this way it reads 3' to 5', not the conventional 5' to 3' direction. For the biologically standard 5'→3' representation of the other strand, use the Reverse Complement tab above.

Reverse Only — flips the sequence order without applying complementary base pairing. E.g. ATGC → CGTA. Useful for checking palindromic sequences or comparing read direction.

ATGCGT
GAATTC (EcoRI)
AATTCGGGCCC
Error
✓ This sequence is palindromic (its reverse complement equals the original) — common in restriction enzyme recognition sites like EcoRI (GAATTC) and BamHI (GGATCC).
Reversed Sequence (no complementing)

Note: This reverses the order of bases without applying complementary base pairing. To check if a sequence is palindromic (reverse complement equals original — common in restriction enzyme sites), compare this output to the Reverse Complement result. Palindromic check:

Transcription: Coding strand → mRNA is a direct T→U substitution. Template strand → mRNA is the reverse complement with T→U, since RNA polymerase reads the template 3'→5' and synthesizes mRNA 5'→3'.

Input Strand
ATGAAGTTTGCGGCC
ATGCGT
ATGCGTACGGCT
Error
Input DNA Sequence
mRNA Sequence (5'→3')
IUPAC Ambiguity Codes Reference

Real sequencing data often contains IUPAC ambiguity codes representing positions where the base is not fully determined — heterozygous positions, low-confidence calls, or degenerate primer design. All codes are supported by the reverse complement calculator above.

Code Meaning Complement Bases Notes
AAdenineTAStandard base
TThymine (DNA only)ATStandard base
GGuanineCGStandard base
CCytosineGCStandard base
UUracil (RNA only)AUReplaces T in RNA
NaNy baseNA/T/G/CUnknown position
RpuRineYA or GR↔Y are complements
YpYrimidineRC or TR↔Y are complements
SStrongSG or CS is self-complementary
WWeakWA or TW is self-complementary
KKetoMG or TK↔M are complements
MaMinoKA or CK↔M are complements
Bnot AVC, G, or TB↔V are complements
Vnot TBA, C, or GV↔B are complements
Dnot CHA, G, or TD↔H are complements
Hnot GDA, C, or TH↔D are complements

What Is a Reverse Complement? — Definition Explained

The reverse complement of a DNA sequence is the sequence of the antiparallel complementary strand, written in the conventional 5'→3' direction. Understanding why this requires both complementing and reversing requires understanding DNA's double-helix structure.

DNA is a double-stranded molecule where two strands run in opposite directions — one from 5' to 3', the other from 3' to 5' (antiparallel). The two strands are held together by Watson-Crick base pairs: A pairs with T, T pairs with A, G pairs with C, C pairs with G. Every base on one strand has a specific complementary partner on the other.

There are three distinct operations — do not confuse them:

  • Complement: Replace each base with its pair, keep the same left-to-right order. Gives the other strand in the same direction as written — but since that strand runs antiparallel, this is actually 3'→5'.
  • Reverse: Flip the sequence order, same bases, no base-pairing applied. Does NOT change which bases are present.
  • Reverse Complement: Complement every base first, then reverse the entire result. This gives the antiparallel strand read in standard 5'→3' direction — the biologically meaningful operation for PCR primers, BLAST, and restriction site analysis.
Input sequence (5'→3'): 5'-A T G C G T A C-3' | | | | | | | | Complement (3'→5', same order): 3'-T A C G C A T G-5' ↕ reverse ↕ Reverse Complement (5'→3'): 5'-G T A C G C A T-3'

The "aha" moment: the bottom strand in the double helix already contains the complementary bases, but it runs right-to-left physically. To read it in the standard 5'→3' direction (left-to-right), you must flip it. The reverse complement IS the antiparallel strand in readable form.

How to Find the Reverse Complement — Step-by-Step Method

Finding the reverse complement of any DNA or RNA sequence takes exactly two steps:

  1. Step 1 — Complement every base: For DNA, apply A↔T and G↔C. For RNA, apply A↔U and G↔C. Work through every base left-to-right.
  2. Step 2 — Reverse the entire complemented sequence: Flip the string from Step 1 so the last character becomes first.

Example 1: ATGC

  1. Complement (A→T, T→A, G→C, C→G): ATGC → TACG
  2. Reverse TACG: → GCAT
  3. Reverse Complement of ATGC = GCAT

Example 2: GGATCC (BamHI restriction site)

  1. Complement (A pairs with T, G pairs with C): GGATCC → CCTAGG
  2. Reverse CCTAGG: → GGATCC
  3. Reverse Complement = GGATCC — same as the original! This is a palindromic sequence.

Example 3: AATTCGGGCCC

  1. Complement: AATTCGGGCCC → TTAAGCCCGGG
  2. Reverse TTAAGCCCGGG: → GGGCCCGAATT
  3. Reverse Complement = GGGCCCGAATT

Complement vs Reverse vs Reverse Complement

All three operations start from the same input sequence but produce different results. The reverse complement is almost always the biologically relevant result.

Operation Input: ATGCGT How it works Direction Lab use
Original ATGCGT Unchanged 5'→3' Sense/coding strand
Complement TACGCA A↔T, G↔C applied; same order 3'→5' (antiparallel) Base-pairing diagrams
Reverse TGCGTA Order flipped; no base pairing 5'→3' (backward sense) Palindrome checking
Reverse Complement ACGCAT A↔T, G↔C then reversed 5'→3' (antiparallel) PCR primers, BLAST, cloning

Key rule: For the reverse complement, always complement FIRST, then reverse. Reversing first and then complementing gives the same final result for standard bases (A, T, G, C) — but gives WRONG results for asymmetric IUPAC codes like R and Y (where R→Y but Y→R).

IUPAC Ambiguity Codes and Their Complements

Real sequencing data routinely contains IUPAC ambiguity codes — single letters representing positions where more than one base is possible. These appear in three contexts:

  • Heterozygous positions: A diploid organism has two alleles; if they differ at a position, the base call is ambiguous (e.g. R = A or G if one allele has A and the other has G).
  • Low-confidence base calls: Sequencing errors or low coverage produce N (any base) at uncertain positions.
  • Degenerate primer design: Primers targeting conserved regions across multiple species may use ambiguity codes to match several possible sequences simultaneously.

The complement of an ambiguity code follows the same logic as standard bases — if R = (A or G), then the complement of R must cover the complements of A and G, which are T and C respectively = Y (pyrimidine). So R↔Y. Similarly N complements to N, S complements to S (G/C pairs with C/G), and W complements to W (A/T pairs with T/A).

See the full IUPAC reference table in the calculator section above for all 16 codes and their complements.

Why Reverse Complement Matters — Real Lab Applications

PCR Primer Design

In PCR, the forward primer matches the sense strand (5'→3'). The reverse primer must anneal to the opposite (antisense) strand and extend toward the forward primer. Since the antisense strand runs antiparallel, the reverse primer sequence must be the reverse complement of the target region's end sequence on the sense strand. Entering your target sequence into the reverse complement calculator gives you the reverse primer sequence directly.

Restriction Enzyme Site Analysis

Most restriction enzyme recognition sites are palindromic — the reverse complement equals the original sequence. For example, EcoRI recognizes 5'-GAATTC-3'. Its complement is 3'-CTTAAG-5', which read 5'→3' is GAATTC — same sequence. This palindromic symmetry allows the enzyme to bind and cut both strands. Our reverse complement calculator flags palindromic sequences automatically.

BLAST Database Searches

When a sequence query matches a database hit on the minus strand (opposite orientation), BLAST reports the alignment using the reverse complement of your query. Understanding this requires knowing that the hit sequence is read on the antiparallel strand in the 5'→3' direction — exactly what reverse complement produces.

Cloning and Plasmid Design

When inserting a DNA fragment into a plasmid in a specific orientation, you need to know what sequence appears on each strand. The reverse complement tells you what the bottom strand reads when your insert is in either forward or reverse orientation.

CRISPR Guide RNA Design

CRISPR guide RNAs target specific genomic sequences followed by a PAM site (e.g. NGG for SpCas9). The guide RNA can target either genomic strand — if your target sequence is on the minus strand, you need the reverse complement of the plus strand sequence to design the guide. Our reverse complement calculator includes RNA output for this purpose.

Common Mistakes With Reverse Complement Calculations

Mistake 1 — Stopping at Complement Only (Forgetting to Reverse)

  • ❌ Wrong: "Reverse complement of ATGC is TACG" — this is just the complement
  • ✅ Correct: Complement ATGC → TACG, then reverse → GCAT. Reverse complement = GCAT

Mistake 2 — Reversing Before Complementing (Wrong Order for Ambiguity Codes)

  • ❌ Wrong order for ATGNRY: reverse first (YRNGT A), then complement gives wrong result for R and Y
  • ✅ Correct order: complement first (TACNYR), then reverse (RYNCAT). The reverse complement of ATGNRY = RYNCAT — R→Y and Y→R are applied correctly only when complement comes first

Mistake 3 — Forgetting T→U for RNA

  • ❌ Wrong: RNA complement of AUGCGU is TACGCA (using T instead of U)
  • ✅ Correct: For RNA, A pairs with U, G pairs with C. Complement of AUGCGU is UACGCA. Reverse complement of AUGCGU is ACGCAU

Mistake 4 — Mishandling Lowercase (Repeat-Masked Sequences)

  • ❌ Wrong: Treating lowercase letters in repeat-masked genomic sequences as invalid
  • ✅ Correct: Genomic sequences from databases often use lowercase for repeat-masked regions (e.g. "atgcATGC"). The complement calculator should uppercase all input before processing. Our tool does this automatically — lowercase is accepted and uppercased in output.

Mistake 5 — Including FASTA Header Lines in the Sequence

  • ❌ Wrong: Pasting ">sequence_name\nATGCGT" and including the ">sequence_name" line in the calculation
  • ✅ Correct: The FASTA format uses ">" lines as headers — they must be stripped before complementing. Our reverse complement calculator automatically detects any line starting with ">" and excludes it, processing only the sequence lines below.

Worked Examples

InputReverse ComplementNotes
ATGCGCATSimple 4-mer: A↔T, T↔A, G↔C, C↔G, then reversed
GAATTCGAATTCEcoRI palindrome — reverse complement = original
GGATCCGGATCCBamHI palindrome — both strands read 5'-GGATCC-3'
ATGCGTACGGCTAACGTTAGCGCTAACGTTAGCCGTACGCAT21-mer example
ATGNRYATGCGCATRYNCATN→N, R→Y, Y→R — ambiguity codes handled correctly
AATTCGGGCCCGGGCCCGAATTAsymmetric sequence with G/C rich region
AUGCGU (RNA)ACGCAURNA: A↔U, G↔C — note U not T in complement
GCATGCGCATGCSphI palindromic recognition site

Full Worked Example: ATGNRYATGC (with IUPAC codes)

  1. Input: A T G N R Y A T G C
  2. Complement each base (A→T, T→A, G→C, N→N, R→Y, Y→R, C→G):
    A→T, T→A, G→C, N→N, R→Y, Y→R, A→T, T→A, G→C, C→G
    = T A C N Y R T A C G
  3. Reverse TACNYRTACG:
    = G C A T R Y N C A T
  4. Reverse complement = GCATRYNCAT

Palindrome Verification: GAATTC (EcoRI)

  1. Input: G A A T T C
  2. Complement: G→C, A→T, A→T, T→A, T→A, C→G = C T T A A G
  3. Reverse CTTAAG: = G A A T T C
  4. Reverse complement (GAATTC) equals original (GAATTC) → ✓ Palindromic

Frequently Asked Questions

What is the reverse complement of a DNA sequence?
The reverse complement is found by two steps: (1) replace every base with its complementary pair — A pairs with T, T pairs with A, G pairs with C, C pairs with G for DNA — and (2) reverse the entire resulting sequence. For example, ATGC → complement TACG → reversed GCAT. The reverse complement represents the antiparallel strand of the double helix read in the standard 5'→3' direction.
Why is it called "reverse" AND "complement" — why both operations?
DNA is antiparallel — the complementary strand runs in the opposite direction to your input. When you complement a sequence (replace each base with its pair), you get the bases of the other strand but still written in the same left-to-right order as your input. Since the other strand physically runs in the opposite direction, to read it in the conventional 5'→3' direction you must also reverse the order. Both operations together — the complement AND the reversal — produce the reverse complement: the antiparallel strand in standard readable form.
How do you find the complement of a DNA sequence?
Replace each base with its Watson-Crick pair, keeping the same left-to-right order: A pairs with T, T pairs with A, G pairs with C, C pairs with G. Do NOT reverse the sequence. For example, complement of ATGCGT is TACGCA. For RNA, use A pairs with U, U pairs with A, G pairs with C, C pairs with G instead. The complement gives the other strand's bases but represents the antiparallel strand read 3'→5'. To get it in 5'→3' orientation, you need the reverse complement instead.
What is a palindromic DNA sequence?
A palindromic DNA sequence is one where the reverse complement equals the original sequence. Both strands read the same sequence in the 5'→3' direction. For example, GAATTC (EcoRI): complement is CTTAAG, reversed is GAATTC = original. Nearly all restriction enzyme recognition sites are palindromic — the symmetry allows the enzyme to bind and cut both strands at equivalent positions. Our reverse complement calculator automatically detects and flags palindromic sequences.
How does the reverse complement relate to PCR primer design?
The reverse primer in PCR must anneal to the antisense (bottom) strand and extend toward the forward primer. Because the antisense strand runs antiparallel to the sense strand, the reverse primer sequence must be the reverse complement of the 3' end of your target region on the sense strand. If your target region ends in 5'-ATGCGT-3' on the sense strand, your reverse primer should be 5'-ACGCAT-3' (the reverse complement of ATGCGT). Enter your target sequence into the reverse complement calculator and use the result as your reverse primer sequence.
What is the difference between DNA and RNA complementing?
For DNA: A pairs with T, T pairs with A, G pairs with C, C pairs with G. For RNA: Thymine (T) does not exist — it is replaced by Uracil (U). RNA base pairing rules are A pairs with U, U pairs with A, G pairs with C, C pairs with G. When transcribing DNA to mRNA (via our DNA→mRNA tool), the coding strand undergoes direct T→U substitution, while the template strand requires the reverse complement with T→U applied. The reverse complement calculator handles both DNA and RNA modes with a single toggle.

Related Calculators

Base Pairing Rules

DNA: A pairs with T, G pairs with C

AT
Adenine — Thymine (2 H-bonds)
TA
Thymine — Adenine (2 H-bonds)
GC
Guanine — Cytosine (3 H-bonds)
CG
Cytosine — Guanine (3 H-bonds)

RNA: A pairs with U, G pairs with C

AU
Adenine — Uracil
UA
Uracil — Adenine
GC
Guanine — Cytosine
CG
Cytosine — Guanine
Quick Examples
ATGCGTACGGCTAACGTTAGC → GCTAACGTTAGCCGTACGCAT
GAATTC → GAATTC (EcoRI palindrome)
GGATCC → GGATCC (BamHI palindrome)
ATGC → GCAT
ATGNRYATGC → GCATRYNCAT
AATTCGGGCCC → GGGCCCGAATT

Data Sources & References

  • Watson-Crick base pairing and complementarity: Watson, J.D. & Crick, F.H.C. (1953). "Molecular structure of nucleic acids." Nature 171: 737–738. DOI 10.1038/171737a0
  • IUPAC nucleotide ambiguity codes: Nomenclature Committee of the International Union of Biochemistry (1985). European Journal of Biochemistry 150: 1–5. DOI 10.1111/j.1432-1033
  • Primer Tm calculation (Wallace Rule): Wallace, R.B. et al. (1979). Nucleic Acids Research 6(11): 3543–3557.
Shahid Ali — Lead Developer, CECOS University Academically Verified
Calculator methods archived with DOI · Last verified: August 2026

Free chemistry, physics, biology & math calculators with step-by-step solutions. Trusted by 1000+ students. Solve any science problem instantly!

Scroll to Top