Reverse Complement Calculator
Find the reverse complement, complement, and reverse of any DNA or RNA sequence instantly. Supports IUPAC ambiguity codes, FASTA input, GC content analysis, palindrome detection, and DNA-to-mRNA transcription. The most complete complementary sequence tool available.
⬆ The complement strand (bottom) reads 3'→5' in the same left-to-right order. Flipping it gives the reverse complement reading 5'→3' — the biologically standard orientation of the antiparallel strand.
| Base | Count | Percentage |
|---|
→ For molecular weight, see our 🧬 DNA Molecular Weight Calculator
Complement Only — replaces each base with its Watson-Crick partner, keeping the same left-to-right sequence order. For DNA: A pairs with T, T pairs with A, G pairs with C, C pairs with G. For RNA: A pairs with U, U pairs with A, G pairs with C, C pairs with G.
⚠️ Direction note: This shows the complementary bases in the same left-to-right order as your input. Biologically, this represents the antiparallel strand — but written this way it reads 3' to 5', not the conventional 5' to 3' direction. For the biologically standard 5'→3' representation of the other strand, use the Reverse Complement tab above.
Reverse Only — flips the sequence order without applying complementary base pairing. E.g. ATGC → CGTA. Useful for checking palindromic sequences or comparing read direction.
Note: This reverses the order of bases without applying complementary base pairing. To check if a sequence is palindromic (reverse complement equals original — common in restriction enzyme sites), compare this output to the Reverse Complement result. Palindromic check: —
Transcription: Coding strand → mRNA is a direct T→U substitution. Template strand → mRNA is the reverse complement with T→U, since RNA polymerase reads the template 3'→5' and synthesizes mRNA 5'→3'.
Real sequencing data often contains IUPAC ambiguity codes representing positions where the base is not fully determined — heterozygous positions, low-confidence calls, or degenerate primer design. All codes are supported by the reverse complement calculator above.
| Code | Meaning | Complement | Bases | Notes |
|---|---|---|---|---|
| A | Adenine | T | A | Standard base |
| T | Thymine (DNA only) | A | T | Standard base |
| G | Guanine | C | G | Standard base |
| C | Cytosine | G | C | Standard base |
| U | Uracil (RNA only) | A | U | Replaces T in RNA |
| N | aNy base | N | A/T/G/C | Unknown position |
| R | puRine | Y | A or G | R↔Y are complements |
| Y | pYrimidine | R | C or T | R↔Y are complements |
| S | Strong | S | G or C | S is self-complementary |
| W | Weak | W | A or T | W is self-complementary |
| K | Keto | M | G or T | K↔M are complements |
| M | aMino | K | A or C | K↔M are complements |
| B | not A | V | C, G, or T | B↔V are complements |
| V | not T | B | A, C, or G | V↔B are complements |
| D | not C | H | A, G, or T | D↔H are complements |
| H | not G | D | A, C, or T | H↔D are complements |
What Is a Reverse Complement? — Definition Explained
The reverse complement of a DNA sequence is the sequence of the antiparallel complementary strand, written in the conventional 5'→3' direction. Understanding why this requires both complementing and reversing requires understanding DNA's double-helix structure.
DNA is a double-stranded molecule where two strands run in opposite directions — one from 5' to 3', the other from 3' to 5' (antiparallel). The two strands are held together by Watson-Crick base pairs: A pairs with T, T pairs with A, G pairs with C, C pairs with G. Every base on one strand has a specific complementary partner on the other.
There are three distinct operations — do not confuse them:
- Complement: Replace each base with its pair, keep the same left-to-right order. Gives the other strand in the same direction as written — but since that strand runs antiparallel, this is actually 3'→5'.
- Reverse: Flip the sequence order, same bases, no base-pairing applied. Does NOT change which bases are present.
- Reverse Complement: Complement every base first, then reverse the entire result. This gives the antiparallel strand read in standard 5'→3' direction — the biologically meaningful operation for PCR primers, BLAST, and restriction site analysis.
The "aha" moment: the bottom strand in the double helix already contains the complementary bases, but it runs right-to-left physically. To read it in the standard 5'→3' direction (left-to-right), you must flip it. The reverse complement IS the antiparallel strand in readable form.
How to Find the Reverse Complement — Step-by-Step Method
Finding the reverse complement of any DNA or RNA sequence takes exactly two steps:
- Step 1 — Complement every base: For DNA, apply A↔T and G↔C. For RNA, apply A↔U and G↔C. Work through every base left-to-right.
- Step 2 — Reverse the entire complemented sequence: Flip the string from Step 1 so the last character becomes first.
Example 1: ATGC
- Complement (A→T, T→A, G→C, C→G): ATGC → TACG
- Reverse TACG: → GCAT
- Reverse Complement of ATGC = GCAT
Example 2: GGATCC (BamHI restriction site)
- Complement (A pairs with T, G pairs with C): GGATCC → CCTAGG
- Reverse CCTAGG: → GGATCC
- Reverse Complement = GGATCC — same as the original! This is a palindromic sequence.
Example 3: AATTCGGGCCC
- Complement: AATTCGGGCCC → TTAAGCCCGGG
- Reverse TTAAGCCCGGG: → GGGCCCGAATT
- Reverse Complement = GGGCCCGAATT
Complement vs Reverse vs Reverse Complement
All three operations start from the same input sequence but produce different results. The reverse complement is almost always the biologically relevant result.
| Operation | Input: ATGCGT | How it works | Direction | Lab use |
|---|---|---|---|---|
| Original | ATGCGT | Unchanged | 5'→3' | Sense/coding strand |
| Complement | TACGCA | A↔T, G↔C applied; same order | 3'→5' (antiparallel) | Base-pairing diagrams |
| Reverse | TGCGTA | Order flipped; no base pairing | 5'→3' (backward sense) | Palindrome checking |
| Reverse Complement | ACGCAT | A↔T, G↔C then reversed | 5'→3' (antiparallel) | PCR primers, BLAST, cloning |
Key rule: For the reverse complement, always complement FIRST, then reverse. Reversing first and then complementing gives the same final result for standard bases (A, T, G, C) — but gives WRONG results for asymmetric IUPAC codes like R and Y (where R→Y but Y→R).
IUPAC Ambiguity Codes and Their Complements
Real sequencing data routinely contains IUPAC ambiguity codes — single letters representing positions where more than one base is possible. These appear in three contexts:
- Heterozygous positions: A diploid organism has two alleles; if they differ at a position, the base call is ambiguous (e.g. R = A or G if one allele has A and the other has G).
- Low-confidence base calls: Sequencing errors or low coverage produce N (any base) at uncertain positions.
- Degenerate primer design: Primers targeting conserved regions across multiple species may use ambiguity codes to match several possible sequences simultaneously.
The complement of an ambiguity code follows the same logic as standard bases — if R = (A or G), then the complement of R must cover the complements of A and G, which are T and C respectively = Y (pyrimidine). So R↔Y. Similarly N complements to N, S complements to S (G/C pairs with C/G), and W complements to W (A/T pairs with T/A).
See the full IUPAC reference table in the calculator section above for all 16 codes and their complements.
Why Reverse Complement Matters — Real Lab Applications
PCR Primer Design
In PCR, the forward primer matches the sense strand (5'→3'). The reverse primer must anneal to the opposite (antisense) strand and extend toward the forward primer. Since the antisense strand runs antiparallel, the reverse primer sequence must be the reverse complement of the target region's end sequence on the sense strand. Entering your target sequence into the reverse complement calculator gives you the reverse primer sequence directly.
Restriction Enzyme Site Analysis
Most restriction enzyme recognition sites are palindromic — the reverse complement equals the original sequence. For example, EcoRI recognizes 5'-GAATTC-3'. Its complement is 3'-CTTAAG-5', which read 5'→3' is GAATTC — same sequence. This palindromic symmetry allows the enzyme to bind and cut both strands. Our reverse complement calculator flags palindromic sequences automatically.
BLAST Database Searches
When a sequence query matches a database hit on the minus strand (opposite orientation), BLAST reports the alignment using the reverse complement of your query. Understanding this requires knowing that the hit sequence is read on the antiparallel strand in the 5'→3' direction — exactly what reverse complement produces.
Cloning and Plasmid Design
When inserting a DNA fragment into a plasmid in a specific orientation, you need to know what sequence appears on each strand. The reverse complement tells you what the bottom strand reads when your insert is in either forward or reverse orientation.
CRISPR Guide RNA Design
CRISPR guide RNAs target specific genomic sequences followed by a PAM site (e.g. NGG for SpCas9). The guide RNA can target either genomic strand — if your target sequence is on the minus strand, you need the reverse complement of the plus strand sequence to design the guide. Our reverse complement calculator includes RNA output for this purpose.
Common Mistakes With Reverse Complement Calculations
Mistake 1 — Stopping at Complement Only (Forgetting to Reverse)
- ❌ Wrong: "Reverse complement of ATGC is TACG" — this is just the complement
- ✅ Correct: Complement ATGC → TACG, then reverse → GCAT. Reverse complement = GCAT
Mistake 2 — Reversing Before Complementing (Wrong Order for Ambiguity Codes)
- ❌ Wrong order for ATGNRY: reverse first (YRNGT A), then complement gives wrong result for R and Y
- ✅ Correct order: complement first (TACNYR), then reverse (RYNCAT). The reverse complement of ATGNRY = RYNCAT — R→Y and Y→R are applied correctly only when complement comes first
Mistake 3 — Forgetting T→U for RNA
- ❌ Wrong: RNA complement of AUGCGU is TACGCA (using T instead of U)
- ✅ Correct: For RNA, A pairs with U, G pairs with C. Complement of AUGCGU is UACGCA. Reverse complement of AUGCGU is ACGCAU
Mistake 4 — Mishandling Lowercase (Repeat-Masked Sequences)
- ❌ Wrong: Treating lowercase letters in repeat-masked genomic sequences as invalid
- ✅ Correct: Genomic sequences from databases often use lowercase for repeat-masked regions (e.g. "atgcATGC"). The complement calculator should uppercase all input before processing. Our tool does this automatically — lowercase is accepted and uppercased in output.
Mistake 5 — Including FASTA Header Lines in the Sequence
- ❌ Wrong: Pasting ">sequence_name\nATGCGT" and including the ">sequence_name" line in the calculation
- ✅ Correct: The FASTA format uses ">" lines as headers — they must be stripped before complementing. Our reverse complement calculator automatically detects any line starting with ">" and excludes it, processing only the sequence lines below.
Worked Examples
| Input | Reverse Complement | Notes |
|---|---|---|
| ATGC | GCAT | Simple 4-mer: A↔T, T↔A, G↔C, C↔G, then reversed |
| GAATTC | GAATTC | EcoRI palindrome — reverse complement = original |
| GGATCC | GGATCC | BamHI palindrome — both strands read 5'-GGATCC-3' |
| ATGCGTACGGCTAACGTTAGC | GCTAACGTTAGCCGTACGCAT | 21-mer example |
| ATGNRYATGC | GCATRYNCAT | N→N, R→Y, Y→R — ambiguity codes handled correctly |
| AATTCGGGCCC | GGGCCCGAATT | Asymmetric sequence with G/C rich region |
| AUGCGU (RNA) | ACGCAU | RNA: A↔U, G↔C — note U not T in complement |
| GCATGC | GCATGC | SphI palindromic recognition site |
Full Worked Example: ATGNRYATGC (with IUPAC codes)
- Input: A T G N R Y A T G C
- Complement each base (A→T, T→A, G→C, N→N, R→Y, Y→R, C→G):
A→T, T→A, G→C, N→N, R→Y, Y→R, A→T, T→A, G→C, C→G
= T A C N Y R T A C G - Reverse TACNYRTACG:
= G C A T R Y N C A T - Reverse complement = GCATRYNCAT
Palindrome Verification: GAATTC (EcoRI)
- Input: G A A T T C
- Complement: G→C, A→T, A→T, T→A, T→A, C→G = C T T A A G
- Reverse CTTAAG: = G A A T T C
- Reverse complement (GAATTC) equals original (GAATTC) → ✓ Palindromic
Frequently Asked Questions
Related Calculators
DNA: A pairs with T, G pairs with C
RNA: A pairs with U, G pairs with C