DNA Molecular Weight Calculator
Calculate DNA molecular weight from sequence or length, convert between ng/µL, nM, and pmol, and determine DNA concentration and purity from A260/A280 spectrophotometer readings — the complete DNA calculator for molecular biology labs.
Molecular Weight (DNA Molecular Weight)
DNA Concentration — Converted Result
A260/A280 Purity Ratio
—| Base | Count | Percentage | Residue Weight (g/mol) |
|---|
ssDNA: MW = (nA × 313.21) + (nT × 304.2) + (nG × 329.21) + (nC × 289.18) + 79.0
dsDNA: MW = ssDNA MW × 2 (complementary strand adds approximately equal mass)
RNA: MW = (nA × 329.2) + (nU × 306.2) + (nG × 345.2) + (nC × 305.2) + 159.0
The +79.0 terminal correction accounts for the 5'-phosphate group. These residue weights are for the phosphodiester chain form (residue = nucleotide monophosphate minus water, connected in chain).
dsDNA: MW ≈ length (bp) × 650 g/mol/bp — includes both strands, accurate to ~2% for typical GC content
ssDNA: MW ≈ length (nt) × 330 g/mol/nt — single strand approximation
RNA: MW ≈ length (nt) × 340 g/mol/nt — ribonucleotide average (slightly heavier than deoxyribonucleotide)
nM = (ng/µL × 10⁶) / MW(g/mol)
ng/µL = (nM × MW) / 10⁶
pmol/µL = (ng/µL × 1000) / MW
ng = (pmol × MW) / 1000
Note: ng/µL = µg/mL numerically (same concentration, different notation).
Concentration (µg/mL) = A260 × dilution factor × extinction coefficient
Standard extinction coefficients (µg/mL per A260 unit, 1 cm path length):
dsDNA = 50 | ssDNA = 33 | RNA = 40 | Oligonucleotides ≈ 20–33 (sequence-dependent)
A260/A280 ratio = A260 / A280 — target: ~1.8 for pure DNA, ~2.0 for pure RNA.
How to Calculate DNA Molecular Weight — Formula and Method
The molecular weight of DNA depends on its base composition, length, and whether it is double-stranded or single-stranded. This DNA molecular weight calculator supports two methods: the precise residue-weight method (using the actual sequence) and the standard laboratory approximation (using only the length).
The Quick Approximation (Most Labs Use This)
For routine work, the accepted laboratory approximations are: dsDNA: 650 g/mol per base pair, ssDNA: 330 g/mol per nucleotide, RNA: 340 g/mol per nucleotide. These are accurate enough for virtually all standard calculations.
The Precise Residue-Weight Method
For exact calculations, use individual base residue weights. Each nucleotide residue in the phosphodiester chain has a specific mass: dAMP = 313.21 g/mol, dTMP = 304.2 g/mol, dGMP = 329.21 g/mol, dCMP = 289.18 g/mol. Add 79.0 g/mol once for the 5'-terminal phosphate correction. GC-rich sequences are slightly heavier than AT-rich sequences — but the 650/330 g/mol approximation is typically within 2–3% of the precise value.
Worked Example 1: ssDNA Oligo ATGCGTACGGCTAACGTTAGC (21 nt)
- Count bases: A=6, T=6, G=5, C=4
- Apply residue weights: (6×313.21) + (6×304.2) + (5×329.21) + (4×289.18) + 79.0
- = 1,879.26 + 1,825.20 + 1,646.05 + 1,156.72 + 79.0
- MW = 6,586.23 g/mol ≈ 6.59 kDa
- Approximation check: 21 × 330 = 6,930 g/mol (within ~5%)
Worked Example 2: dsDNA Plasmid, 4,700 bp
- Use the 650 g/mol/bp approximation: 4,700 × 650 = 3,055,000 g/mol
- MW ≈ 3,055,000 g/mol = 3,055 kDa ≈ 3.06 MDa
- Note: The 650 g/mol per bp figure already includes both strands of the dsDNA duplex.
Converting DNA Concentration — ng/µL to nM and pmol
Spectrophotometers measure mass concentration (ng/µL or µg/mL). But many molecular biology protocols — PCR, ligation, Gibson assembly — require molar concentrations (nM, µM, or pmol amounts) because reactions need equimolar ratios, not equal masses. A short 20-mer oligo and a long 3 kb plasmid at the same ng/µL have very different molar concentrations.
Example 1: ng/µL → nM (oligo at 50 ng/µL)
- 20 bp dsDNA oligo: MW = 20 × 650 = 13,000 g/mol
- nM = (50 × 10⁶) / 13,000 = 3,846 nM ≈ 3.85 µM
Example 2: pmol → ng (total amount in a tube)
- 500 ng of a plasmid with MW = 3,000,000 g/mol
- pmol = (500 × 1,000) / 3,000,000 = 0.167 pmol
- 0.167 pmol of plasmid in that 500 ng sample
Example 3: nM → ng/µL (making up a working stock)
- You want 100 nM of a ssDNA primer (30-mer, MW ≈ 30 × 330 = 9,900 g/mol)
- ng/µL = (100 × 9,900) / 10⁶ = 0.99 ng/µL
- 100 nM primer = 0.99 ng/µL
A260/A280 Ratio — What It Means for DNA Purity
The A260/A280 ratio is the most widely used metric for assessing DNA purity in a molecular biology lab. Every Nanodrop reading automatically calculates it. Understanding what the ratio means — and why deviations in each direction indicate different contaminants — is essential for interpreting DNA quantification data.
The Beer-Lambert Law Foundation
DNA absorbs UV light maximally at 260 nm because of the stacked aromatic rings of the nucleobases. Proteins absorb maximally at 280 nm due to aromatic amino acid residues (phenylalanine, tyrosine, tryptophan). By measuring at both wavelengths, you can estimate the relative amounts of nucleic acid and protein in your sample.
A260/A280 ratio targets: ~1.8 for pure DNA, ~2.0 for pure RNA. These are not thresholds — they are empirically determined values for highly purified samples. Values of 1.7–2.0 for DNA are generally acceptable for downstream applications.
| A260/A280 Ratio | Interpretation | Likely Cause | Action |
|---|---|---|---|
| ~1.8 | ✓ Pure DNA | No significant contamination | Proceed with experiments |
| ~2.0 | ✓ Pure RNA | Target for RNA samples | Proceed with experiments |
| 1.7–2.0 | ✓ Acceptable DNA | Trace contamination | Acceptable for most applications |
| <1.7 | ⚠ Borderline | Protein, phenol, or salt | Consider re-purification |
| <1.5 | ✗ Poor — protein contamination | Incomplete protein removal; phenol carryover from phenol-chloroform extraction | Re-purify: column cleanup, phenol-chloroform, or ethanol precipitation |
| >2.0 (DNA sample) | ⚠ Possible RNA contamination | RNA co-purified with DNA; or A280 near noise floor | Treat with RNase A; re-measure |
| >2.2 | ✗ Poor — significant RNA or artefact | Heavy RNA contamination; or A280 = near zero (noisy low reading) | RNase treatment; re-purify; verify sample is not too dilute |
Why Low Ratio = Protein (Not RNA)
When A260/A280 < 1.8 for a DNA sample, protein contamination is the first suspect. Protein absorbs strongly at 280 nm, raising A280 relative to A260 and dragging the ratio down. Phenol (from phenol-chloroform extractions) also absorbs at 270–280 nm and will produce a low ratio even with minimal protein. SDS and other detergents can similarly lower the ratio.
Why High Ratio = RNA (Not "Extra Pure")
A common misconception is that a higher A260/A280 ratio means "extra pure" DNA. This is wrong. Pure dsDNA targets 1.8 — not 2.0, not 2.5. An elevated ratio for a DNA sample almost always indicates RNA contamination. RNA has a naturally higher intrinsic A260/A280 ratio (~2.0), so RNA carryover pushes a DNA sample's ratio above 1.8. Treat with RNase A and re-quantify.
Extinction Coefficients for Nucleic Acid Quantification
The extinction coefficient (also called the Beer-Lambert extinction factor) determines how much UV light a given concentration of nucleic acid absorbs at 260 nm. These are the standard values used in every molecular biology lab:
| Sample Type | Extinction Coeff. | Meaning | Source |
|---|---|---|---|
| dsDNA | 50 µg/mL per A260 | An A260 reading of 1.0 corresponds to 50 µg/mL dsDNA concentration | Sambrook & Russell (Molecular Cloning) |
| ssDNA | 33 µg/mL per A260 | An A260 of 1.0 = 33 µg/mL ssDNA (lower because ssDNA absorbs more per µg due to unstacked bases) | Standard laboratory convention |
| RNA | 40 µg/mL per A260 | An A260 of 1.0 = 40 µg/mL RNA | Standard laboratory convention |
| Oligonucleotides | 20–33 µg/mL per A260 | Varies by sequence; use nearest-neighbor method for short oligos for precision | IDT OligoAnalyzer (nearest-neighbor) |
For short synthetic oligonucleotides, the flat 33 µg/mL approximation introduces significant error because individual bases have very different molar extinction coefficients (A absorbs much more strongly than C at 260 nm). For precise oligo quantification, use the nearest-neighbor method — IDT's OligoAnalyzer tool calculates sequence-specific extinction coefficients for custom oligos. For standard genomic DNA, PCR products, and plasmids, the values in the table above are entirely sufficient.
Common Mistakes in DNA Quantification
Mistake 1 — Using the Wrong Extinction Coefficient
- ❌ Using 50 µg/mL for a ssDNA sample (oligo, primer, or PCR product that was denatured)
- ✅ Use 50 for dsDNA, 33 for ssDNA, 40 for RNA — always match the coefficient to your actual sample type
- Error magnitude: using 50 instead of 33 for ssDNA overestimates DNA concentration by ~50%
Mistake 2 — Forgetting the Dilution Factor
- ❌ Reading A260 from a 1:10 diluted sample and not multiplying by 10
- ✅ Concentration = A260 × dilution factor × extinction coefficient — the dilution factor is critical
- Error magnitude: a forgotten ×10 dilution factor gives a 10× underestimate of DNA concentration
Mistake 3 — Confusing ng/µL with ng/mL
- ❌ Reporting 50 µg/mL (from the Beer-Lambert formula) as 50 ng/µL → then converting as if this is 50 ng/µL when actually it should equal 50 ng/µL already
- ✅ Numerically, µg/mL = ng/µL (both = 1 µg/1000 µL = 1000 ng/1000 µL = 1 ng/µL — wait, 1 µg/mL = 1 ng/µL? Yes: 1 µg = 1000 ng, 1 mL = 1000 µL, so 1 µg/mL = 1000 ng / 1000 µL = 1 ng/µL ✓)
- The trap: ng/mL ≠ ng/µL. 1 ng/mL = 0.001 ng/µL. Confusing mL and µL gives a 1000× error.
Mistake 4 — Using 650 g/mol/bp for Very Short Oligos
- ❌ A 10-mer dsDNA oligo calculated at 10 × 650 = 6,500 g/mol — end effects matter for short oligos
- ✅ For oligos shorter than ~20 bp, use the precise residue-weight method (Tool 1 Mode A) or the ssDNA approximation × 2. The 650/bp figure assumes average base composition and fully accounts for internal phosphodiester bonds; end effects make short oligos slightly lighter than the approximation predicts.
Mistake 5 — Misinterpreting High A260/A280 Ratio as "Very Pure"
- ❌ A260/A280 = 2.3 for a DNA sample → "Great, super pure DNA!"
- ✅ For DNA, the target A260/A280 ratio is ~1.8, not 2.0 or higher. A ratio of 2.3 indicates RNA contamination — RNA has an intrinsically higher ratio (~2.0) and its presence raises your DNA sample's ratio above 1.8. Treat with RNase A and re-measure.
Worked Examples
| Problem | Formula Used | Result |
|---|---|---|
| MW of ssDNA oligo ATGCGTACGGCTAACGTTAGC | Residue weights + 79.0 | 6,586 g/mol ≈ 6.59 kDa |
| MW of 1,000 bp dsDNA (approx.) | 1,000 × 650 | 650,000 g/mol = 650 kDa |
| 50 ng/µL of 20-mer dsDNA → nM | (50 × 10⁶) / 13,000 | 3,846 nM = 3.85 µM |
| 3,846 nM → ng/µL (verify above) | (3846 × 13,000) / 10⁶ | 50 ng/µL ✓ |
| 500 ng plasmid (3 Mb) → pmol | (500 × 1000) / 3,000,000 | 0.167 pmol |
| A260=0.85, ×10 dsDNA → concentration | 0.85 × 10 × 50 | 425 µg/mL = 425 ng/µL |
| A260=0.60, A280=0.45 → purity ratio | 0.60 / 0.45 | 1.33 → ✗ Poor (protein contamination) |
| MW of 500 nt RNA (approx.) | 500 × 340 | 170,000 g/mol = 170 kDa |
Frequently Asked Questions
Related Calculators
| Type | µg/mL per A260 |
|---|---|
| dsDNA | 50 |
| ssDNA | 33 |
| RNA | 40 |
| Oligonucleotide | 20–33 |
| Base | DNA | RNA |
|---|---|---|
| A | 313.21 | 329.2 |
| T/U | 304.2 (T) | 306.2 (U) |
| G | 329.21 | 345.2 |
| C | 289.18 | 305.2 |
| +Terminal | +79.0 (5' phosphate) | |